Creation How Science Is Reinventing Life Itself
Download Creation How Science Is Reinventing Life Itself PDF/ePub or read online books in Mobi eBooks. Click Download or Read Online button to get Creation How Science Is Reinventing Life Itself book now. This website allows unlimited access to, at the time of writing, more than 1.5 million titles, including hundreds of thousands of titles in various foreign languages.
Creation
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Creation
What is life? Humans have been asking this question for thousands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.
Creation
Within the first billion years after this planet formed, a spark of life spontaneously ignited, turning inanimate chemicals into a living thing: a cell. Rutherford shows how unprecedented advances in the understanding of life have equipped society with the ability to create entirely new life-forms.